View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_71 (Length: 259)
Name: NF0549_low_71
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_71 |
 | |
|
| [»] scaffold0251 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0251 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 65 - 259
Target Start/End: Original strand, 6467 - 6657
Alignment:
| Q |
65 |
aataagttctcttaaaaagtgctaagagaacatgatcaccttaaagggagctaagttttttcgaagaacaactagaatattagtctcctcaacttggatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6467 |
aataagttctcttaaaaagtgctaagagaacatgatcaccttaaagggagctaagttttttcgaagaacaactagaatattagtctcctcaacttggatt |
6566 |
T |
|
| Q |
165 |
cctgtagtccaaacatatatatgtactgaatcaaaattattggctaaactaacagagcaacacctacttagaacaatcccagcaactccaacttt |
259 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
6567 |
cctgtagtccaaac----atatgtactgaaacaaaattattggctaaactaacagagcaaaaccaatttagaacaatcccagcaactccaacttt |
6657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 71
Target Start/End: Original strand, 4541 - 4583
Alignment:
| Q |
29 |
aattcacactagtaggcatcctgtctaacaatgatgaataagt |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4541 |
aattcacactagtaggcatcctgtctaacaatgatgaataagt |
4583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1588 times since January 2019
Visitors: 3672