View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_72 (Length: 259)
Name: NF0549_low_72
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_72 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 21 - 259
Target Start/End: Original strand, 2786164 - 2786402
Alignment:
| Q |
21 |
acatcatcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786164 |
acatcgtcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
2786263 |
T |
 |
| Q |
121 |
caagagggggtttcgcatcaacaggtggattgacagctccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaat |
220 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786264 |
caagagggggtttagcatcaaccggtggattgacagctccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaat |
2786363 |
T |
 |
| Q |
221 |
agaaaactgcggaaatgctttagcaacatcttcagcatc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786364 |
agaaaactgcggaaatgctttagcaacatcttcagcatc |
2786402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 221
Target Start/End: Complemental strand, 22517521 - 22517462
Alignment:
| Q |
162 |
gcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaata |
221 |
Q |
| |
|
||||||||||||||||| ||||||||||| | | ||||||||| ||| |||||||||||| |
|
|
| T |
22517521 |
gcattgtagatggctttaattttgggaagttgttttgggcagacgaccgatagagaaata |
22517462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 125
Target Start/End: Complemental strand, 22518281 - 22518232
Alignment:
| Q |
76 |
gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
22518281 |
gactcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga |
22518232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University