View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0549_low_73 (Length: 256)

Name: NF0549_low_73
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0549_low_73
NF0549_low_73
[»] chr8 (1 HSPs)
chr8 (7-256)||(16331526-16331779)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 16331526 - 16331779
Alignment:
7 tcgaataatattactttcggtagaagaattttacgagaaataaatatagaccttttggaccatagaccccccat----gcctttagcactaaaaccaaca 102  Q
    |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||     ||||||||||||||||||||||    
16331526 tcgaataagattactttcggtagaagaattttacaagaaataaatatagaccttttggaccatagaccacccaaccaagcctttagcactaaaaccaaca 16331625  T
103 tgtaaacactcctttatttgggtatgagttaaaatttctaacttagtatcattgcctaattatccctaaaaacatgtactacgatccaaacctaagaatc 202  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
16331626 tgtaaacactcctttatttgggtatgagttaaaattactaacttagtatcattgcctaattatccctaaaaacatgtactatgatccaaacctaagaatc 16331725  T
203 taaaatttaaaaatagggtgtctgattcaacacagaaaaaggtacgtgtaggta 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16331726 taaaatttaaaaatagggtgtctgattcaacacagaaaaaggtacgtgtaggta 16331779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 449 times since January 2019
Visitors: 3651