View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_80 (Length: 251)
Name: NF0549_low_80
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_80 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 2786790 - 2786548
Alignment:
| Q |
9 |
caacaatatcgccaagtccctttgtgggaacgaacctgctgtttccaactctcagtttgccctagtcacctatcatactcatggcatttatgctcctgtt |
108 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2786790 |
caacaaaatcgtcaagtccctttgtgggaacgaacctgctgtttccaacgctcagtttgccctagtcacctatcatactcatggcatttattctcctgtt |
2786691 |
T |
|
| Q |
109 |
ctcgtgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggttttaatgacaccgctgtcg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2786690 |
ctcgtgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggtttaaatgacaccgctgtcg |
2786591 |
T |
|
| Q |
209 |
ctgaagggcttgctgaagctttgatgatgttctccccgtctca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786590 |
ctgaagggcttgctgaagctttgatgatgttctccccgtctca |
2786548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 109 - 234
Target Start/End: Original strand, 22515971 - 22516096
Alignment:
| Q |
109 |
ctcgtgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggttttaatgacaccgctgtcg |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||||||||| | ||| || ||||||| | ||||| |||||||||||||||||| | ||| | | |
|
|
| T |
22515971 |
ctcgtgcaacgtactggctggacaagagacccagatgttttcttacagtggctagaatctataccattttctggtggtggttttaatgacgcagctattg |
22516070 |
T |
|
| Q |
209 |
ctgaagggcttgctgaagctttgatg |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
22516071 |
ctgaagggcttgctgaagctctgatg |
22516096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1864 times since January 2019
Visitors: 3673