View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_86 (Length: 236)
Name: NF0549_low_86
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 25 - 147
Target Start/End: Original strand, 2563230 - 2563352
Alignment:
| Q |
25 |
tatcttggagagtctatgaaaataacttatgaacatgtcataannnnnnnncgaaattattgtaaagctaatattagtagataaattcaaataagtcggt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2563230 |
tatcttggagagtctatgaaaataacttatgaacatgtcataattttttttcgaaattattgtaaagctaatattagtagataaattcaaaaaagtcggt |
2563329 |
T |
|
| Q |
125 |
ctaaacatactctatcatatgat |
147 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
2563330 |
ctaaacatactgtatcatatgat |
2563352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1580 times since January 2019
Visitors: 3672