View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_90 (Length: 224)
Name: NF0549_low_90
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 7928022 - 7927831
Alignment:
| Q |
1 |
acactgattcgtcgacaggtatcaattatgtcacatgcaactacgattctatcctcggtgaagctctgactgcgattctcctcaccaaaatcactatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7928022 |
acactgattcgtcgacaggtatcaattctgtcacatgcgactacgattctatcctcggtgaagctctcactgcgattctcctcaccaaaatcactatgca |
7927923 |
T |
 |
| Q |
101 |
tctctcactaacaacttttcatcttaacttgcttttatttttatgtttnnnnnnntacaacccataataatttgcaaagagatgtttcaaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7927922 |
tctctcactaacaacttttcatcttaacttacttttattttgatgtttaaaaaaatacaacccataataatttgcaaagagatgtttcaaat |
7927831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University