View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_94 (Length: 201)
Name: NF0549_low_94
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 49280877 - 49280743
Alignment:
| Q |
1 |
aagatcttcaaatcaaaaccaaccctttcacttttctcttcaaaaccgactctaaagccgccattgaagctcttttagagcttgaatcaaaagctatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49280877 |
aagatcttcaaatcaaaaccaaccctttcacttttctcttcaaaaccgactctaaagccgccgttgaagctcttttagagcttgaatcaaaagctatcac |
49280778 |
T |
 |
| Q |
101 |
tatcttctcaactaatccaaatctttacaatctct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49280777 |
tatcttctcaactaatccaaatctttacaatctct |
49280743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University