View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0550_high_6 (Length: 294)
Name: NF0550_high_6
Description: NF0550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0550_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 284
Target Start/End: Original strand, 51157979 - 51158246
Alignment:
| Q |
17 |
gccagctaaaccgctataacagtagccttccctgtcaacccttggacatgatcatgcaaatgaataattacaaatttcacattttaatacgagatcacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51157979 |
gccagctaaaccgctataacagtagccttccctgtcaacccttggacatgatcatgcaaatgaataattacagatttcacattttaatacgagatcacca |
51158078 |
T |
|
| Q |
117 |
agttttcctgtctaccttaggtatagcgaaaccaagaactgagagatgattatgacttcactaacaacagcagcaggggagcgtatgcctagaaatggga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51158079 |
agttttcctgtctaccttaggtatagcgaaaccaagaactgagagatgattatgacttcactaacaacagcagcaggggagcgtatgcctagaaatggga |
51158178 |
T |
|
| Q |
217 |
caatatctacctgcaaccagttctctacaactgaccctacaacagcaccagctacgagccctcctatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51158179 |
caatatctacctgcaaccagttctctacaactgaccctacaacagcaccagctacgagccctcctatg |
51158246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1842 times since January 2019
Visitors: 3673