View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0550_high_7 (Length: 260)
Name: NF0550_high_7
Description: NF0550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0550_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 31610849 - 31611079
Alignment:
| Q |
1 |
tatttttgtattatcctgtttctaaattgttatagtaatgtttggctgcaacaagttcaaaaaatatgtgcatgactccgtaaatgtcctaaacaagcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31610849 |
tatttttgtattatcctgtttctaaattgttatagtaatgtttggctgcaacaagttcaaaaaatatgtgcatgactccgtaaatgtcttaaacaagcac |
31610948 |
T |
|
| Q |
101 |
gaaagtagtaataaccaagtcacatcacacgtttgaaccaatcttgtttaatgtttgctctagttttggtactcgaagtaggtgaaattgagcaaaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610949 |
aaaagtagtaataaccaagtcacatcacatgtttgaaccaatcttgtttaatgtttgcactagttttggtactcgaagtaggtgaaattgagcaaaataa |
31611048 |
T |
|
| Q |
201 |
gggttgcttttaagaatgtagagatcatttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31611049 |
gggttgcttttaagaatgtagagatcatttc |
31611079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1541 times since January 2019
Visitors: 3672