View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0550_low_11 (Length: 320)
Name: NF0550_low_11
Description: NF0550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0550_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 284
Target Start/End: Complemental strand, 2432367 - 2432099
Alignment:
Q |
16 |
atgatgaatgtgtactggaggtgtcgtagagcgtctacgaataaatgaatgtattagctatcttgatacaagcttaatgctcataaaaattatgggggta |
115 |
Q |
|
|
||||| |||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| |||| |
|
|
T |
2432367 |
atgataaatgtgtactagatgtgtcgtagagcgtctacgaataaaggaatgtattagctatcttgatagaagcttaatgctcatgaaaattatggtggta |
2432268 |
T |
 |
Q |
116 |
ttggtgttaaagacctcacgacctttaatttggtgaggcttagttatagtcaacggtggaaattcccagcacagattgattcattggtatcgaggctttt |
215 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||| ||||| ||||||| |
|
|
T |
2432267 |
ttggttttaaagacctcacgacctttaatttggtgaggcttagttatattcaacggtggaaattccaaacacagattgattcatttgtatcagggctttt |
2432168 |
T |
 |
Q |
216 |
caaatcacgatatttcccttaaagtactttgctataattgaagcttggttacaaaccaagttttatgtg |
284 |
Q |
|
|
|||| || | ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
2432167 |
caaagcaggttatttccctcaaagtactttgctataattgaagcttggtcacaaaccaagttttatgtg |
2432099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University