View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0550_low_14 (Length: 260)
Name: NF0550_low_14
Description: NF0550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0550_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 31610849 - 31611079
Alignment:
Q |
1 |
tatttttgtattatcctgtttctaaattgttatagtaatgtttggctgcaacaagttcaaaaaatatgtgcatgactccgtaaatgtcctaaacaagcac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
31610849 |
tatttttgtattatcctgtttctaaattgttatagtaatgtttggctgcaacaagttcaaaaaatatgtgcatgactccgtaaatgtcttaaacaagcac |
31610948 |
T |
 |
Q |
101 |
gaaagtagtaataaccaagtcacatcacacgtttgaaccaatcttgtttaatgtttgctctagttttggtactcgaagtaggtgaaattgagcaaaataa |
200 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31610949 |
aaaagtagtaataaccaagtcacatcacatgtttgaaccaatcttgtttaatgtttgcactagttttggtactcgaagtaggtgaaattgagcaaaataa |
31611048 |
T |
 |
Q |
201 |
gggttgcttttaagaatgtagagatcatttc |
231 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
31611049 |
gggttgcttttaagaatgtagagatcatttc |
31611079 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University