View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0550_low_15 (Length: 238)
Name: NF0550_low_15
Description: NF0550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0550_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 27118921 - 27118687
Alignment:
Q |
1 |
aagttgaatgaatgaatactagaaacccgggaagatgcggtgagggtaaagtaatggtgatatatagattagtgggatctattagtggatcctttcataa |
100 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27118921 |
aagttgaatgaaagaatactagaaacccgggaagatgtggtgagggtaaagtaatggtgatatatagattagtgggatctattagtggatcctttcataa |
27118822 |
T |
 |
Q |
101 |
aaataaagtaaggtagataataaaacaaactctggttcatttgtttaatctggataattctgttgatcagctattcgaaannnnnnngctgaaactaaaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
T |
27118821 |
aaataaagtaaggtagataataaaacaaactctcgttcatttgtttaatatggataattatgttgaacagctattcgaaatttttttgctgaaactaaaa |
27118722 |
T |
 |
Q |
201 |
gtatctgttcattcttattgttatttgaagttcttt |
236 |
Q |
|
|
|||| |||||||||||||||||| |||||||||||| |
|
|
T |
27118721 |
gtatatgttcattcttattgtta-ttgaagttcttt |
27118687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University