View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0551_high_6 (Length: 271)

Name: NF0551_high_6
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0551_high_6
NF0551_high_6
[»] chr7 (2 HSPs)
chr7 (7-221)||(40382717-40382931)
chr7 (217-260)||(49070612-49070656)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 40382931 - 40382717
Alignment:
7 gtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttaccttcttctcttcagtggattcttcatcagtagggataggattccacctt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||    
40382931 gtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttactttcttctcttcagtggattcttcataagtagggataggattccacctt 40382832  T
107 actggatatggttccattacctatcactggtgaagtaccctttcgagggagtgcttcagaatgagtttgatattaagccacctaggtgcttcgtcaaagg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40382831 actggatatggttccattacctatcactggtgaagtacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagg 40382732  T
207 gattcagatgtttga 221  Q
    |||||||||||||||    
40382731 gattcagatgtttga 40382717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 49070612 - 49070656
Alignment:
217 tttgaatcagggggaaaa-aagccgtgtctatgcctttgtttctt 260  Q
    ||||||||||||| |||| ||||||||||||||||||||| ||||    
49070612 tttgaatcaggggaaaaaaaagccgtgtctatgcctttgtctctt 49070656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 207 times since January 2019
Visitors: 3675