View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0551_high_9 (Length: 228)

Name: NF0551_high_9
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0551_high_9
NF0551_high_9
[»] chr7 (1 HSPs)
chr7 (1-142)||(49070566-49070708)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 49070708 - 49070566
Alignment:
1 tttacggttccattgagggacatagaggcgtcacgttctctttgagagagataagaaacaaaggcatagacacggctt-ttttccccctgattcaaatct 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||    
49070708 tttacggttccattgagggacatagaggcgtcacgttctctttgagagagataagagacaaaggcatagacacggcttttttttcccctgattcaaatct 49070609  T
100 tgcaacaccctcacactagccacatttccaaatttaccaaaga 142  Q
    |||||||||||||||||||||||||||||||||||||||||||    
49070608 tgcaacaccctcacactagccacatttccaaatttaccaaaga 49070566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University