View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_high_9 (Length: 228)
Name: NF0551_high_9
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0551_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 49070708 - 49070566
Alignment:
Q |
1 |
tttacggttccattgagggacatagaggcgtcacgttctctttgagagagataagaaacaaaggcatagacacggctt-ttttccccctgattcaaatct |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||| |
|
|
T |
49070708 |
tttacggttccattgagggacatagaggcgtcacgttctctttgagagagataagagacaaaggcatagacacggcttttttttcccctgattcaaatct |
49070609 |
T |
 |
Q |
100 |
tgcaacaccctcacactagccacatttccaaatttaccaaaga |
142 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49070608 |
tgcaacaccctcacactagccacatttccaaatttaccaaaga |
49070566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 226 times since January 2019
Visitors: 3675