View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_17 (Length: 271)
Name: NF0551_low_17
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 40382931 - 40382717
Alignment:
| Q |
7 |
gtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttaccttcttctcttcagtggattcttcatcagtagggataggattccacctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40382931 |
gtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttactttcttctcttcagtggattcttcataagtagggataggattccacctt |
40382832 |
T |
 |
| Q |
107 |
actggatatggttccattacctatcactggtgaagtaccctttcgagggagtgcttcagaatgagtttgatattaagccacctaggtgcttcgtcaaagg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40382831 |
actggatatggttccattacctatcactggtgaagtacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagg |
40382732 |
T |
 |
| Q |
207 |
gattcagatgtttga |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40382731 |
gattcagatgtttga |
40382717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 49070612 - 49070656
Alignment:
| Q |
217 |
tttgaatcagggggaaaa-aagccgtgtctatgcctttgtttctt |
260 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
49070612 |
tttgaatcaggggaaaaaaaagccgtgtctatgcctttgtctctt |
49070656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University