View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_19 (Length: 254)
Name: NF0551_low_19
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 8132606 - 8132382
Alignment:
| Q |
1 |
ggaaaacataaaatgtctacacattttattaggactgtgacaaacgttggtgacccaaaatcagtttacaaagtaacaatcaatccacctgaaggaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8132606 |
ggaaaacataaaatgtctacacattttattaggactgtgacaaacgttggtgacccaaaatcagtttacaaagtaacaatcaatccacctgaaggaatgg |
8132507 |
T |
 |
| Q |
101 |
tagtaactgtgaagccagatatgttgccttttagaagggttggtcagaaattgaactttcttgttagggtacaaactagggaagttaagctttcacctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8132506 |
tagtaactgtgaagccagatatgttgccttttagaagggttggtcagaaattgaactttcttgttagggtacaaactagggaagttaagctttcacctgg |
8132407 |
T |
 |
| Q |
201 |
aagttctttactcaagagtggttcc |
225 |
Q |
| |
|
|||||||||| | |||||||||||| |
|
|
| T |
8132406 |
aagttctttagtgaagagtggttcc |
8132382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University