View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_20 (Length: 242)
Name: NF0551_low_20
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0551_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 31037344 - 31037138
Alignment:
Q |
22 |
ttgctgggatacaaagtagttgaccttgtttccatgtgaatgattgtggtgaagaaataatgcctttctgtgaacattgaacaaagtgttgatgttgaag |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31037344 |
ttgctgggatacaaagtagttgaccttgtttccatgtgaatgattgtggtgaagaaataatgcctttctgtgaacattgaacaaagtgttgatgttgaag |
31037245 |
T |
 |
Q |
122 |
ggttccatgatgaagacaaaacagcacatgatgtttaggtttcacacaaatgttttcgacactagaatgtgacatgaaagga------gtcaagtattgt |
215 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
31037244 |
ggttccatgatgaagacagaacaacacatgatgcttaggtttcacacaaatgttttcgacactagaatgtgacatgaaaggagatattgtcaagtattgt |
31037145 |
T |
 |
Q |
216 |
tatcttt |
222 |
Q |
|
|
||||||| |
|
|
T |
31037144 |
tatcttt |
31037138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 219 times since January 2019
Visitors: 3675