View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_21 (Length: 233)
Name: NF0551_low_21
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 7888898 - 7888836
Alignment:
| Q |
28 |
caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgttgcaacagc |
90 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7888898 |
caatttcttcatacctgtcctaggagtatatgggtgtagtggcatccatcttgttgcagcagc |
7888836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 7891163 - 7891101
Alignment:
| Q |
28 |
caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgttgcaacagc |
90 |
Q |
| |
|
|||||| ||||||||| |||| || |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
7891163 |
caatttgttcatacctatccttggagtatttgggtgtagtggcatccatcttgttacaacagc |
7891101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 38138071 - 38138021
Alignment:
| Q |
28 |
caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatct |
78 |
Q |
| |
|
|||||||||||||||| |||| || |||| ||||||||||||||||||||| |
|
|
| T |
38138071 |
caatttcttcatacctatccttggagtatttgggtgtagtggcatccatct |
38138021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 1846558 - 1846612
Alignment:
| Q |
28 |
caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgtt |
82 |
Q |
| |
|
|||||| ||||||||| |||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
1846558 |
caatttgttcatacctatccttggagtatttgggtgtagtggcatccatcttgtt |
1846612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University