View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_23 (Length: 224)
Name: NF0551_low_23
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 43 - 126
Target Start/End: Original strand, 49070566 - 49070650
Alignment:
| Q |
43 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcagggg-gaaaaaagccgtgtctatgcctttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49070566 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcaggggaaaaaaaagccgtgtctatgcctttg |
49070650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1760 times since January 2019
Visitors: 3673