View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_26 (Length: 214)
Name: NF0551_low_26
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0551_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 31037344 - 31037162
Alignment:
Q |
18 |
ttgctgggatacaaagtagttgaccttgtttccatgtgaatgattgtggtgaagaaataatgcctttctgtgaacattgaacaaagtgttgatgttgaag |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31037344 |
ttgctgggatacaaagtagttgaccttgtttccatgtgaatgattgtggtgaagaaataatgcctttctgtgaacattgaacaaagtgttgatgttgaag |
31037245 |
T |
 |
Q |
118 |
ggttccatgatgaagacaaaacaacacatgatgtttaggtttcacacaaatgttttcgacactagaatgtgacatgaaaggag |
200 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31037244 |
ggttccatgatgaagacagaacaacacatgatgcttaggtttcacacaaatgttttcgacactagaatgtgacatgaaaggag |
31037162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1567 times since January 2019
Visitors: 3672