View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_27 (Length: 211)
Name: NF0551_low_27
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 195
Target Start/End: Original strand, 21440593 - 21440777
Alignment:
| Q |
11 |
aatcaatttgactagtggattttgaatatcggtgctatagcactgtaacgtagcagaatttcttctgtagtgtagtgaaatttgaacaaactgctagtct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21440593 |
aatcaatttgactagtggattttgaatagcggtgctatagcagtgtaacgtagcagaatttcttctgtagtgtagtgaaatttgaacaaactgctagtct |
21440692 |
T |
|
| Q |
111 |
ccacacgattgacaacactgctacttactatgagattcacatcacaattcacaacacaacaaattgcatgaactctcatgatgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21440693 |
ccacacgattgacaacactgctacttactatgagattcacatcacaattcacaacacaacaaattgcatgaactctcatgttgat |
21440777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 126
Target Start/End: Original strand, 21439963 - 21440077
Alignment:
| Q |
11 |
aatcaatttgactagtggattttgaatatcggtgctatagcactgtaacgtagcagaatttcttctgtagtgtagtgaaatttgaacaaactgctagtct |
110 |
Q |
| |
|
|||||| |||||||||| | |||||||| || | |||| ||||| | ||||||||||| || |||||||||| | |||| ||||||||||||| || |
|
|
| T |
21439963 |
aatcaacttgactagtgaaatttgaatagtggcaccatagtgctgtagcatagcagaattttttgtgtagtgtagcggaattagaacaaactgctactc- |
21440061 |
T |
|
| Q |
111 |
ccacacgattgacaac |
126 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
21440062 |
ccacacaattgacaac |
21440077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 185
Target Start/End: Complemental strand, 12743131 - 12743080
Alignment:
| Q |
134 |
cttactatgagattcacatcacaattcacaacacaacaaattgcatgaactc |
185 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
12743131 |
cttactatgaaattcacatcacaattcacaacacaaccgattccatgaactc |
12743080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 12742930 - 12742862
Alignment:
| Q |
17 |
tttgactagtggattttgaatatcggtgctatagcactgtaacgtagcagaatttcttctgtagtgtag |
85 |
Q |
| |
|
||||||||||||| |||||||| || ||||||| ||||| |||||||||||| || |||||||||| |
|
|
| T |
12742930 |
tttgactagtggaatttgaatagtggcgctatagtcctgtagtgtagcagaatttgttatgtagtgtag |
12742862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 251 times since January 2019
Visitors: 3675