View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_28 (Length: 207)
Name: NF0551_low_28
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 29671898 - 29672016
Alignment:
| Q |
1 |
ctcagaagaatcttcagcattctttgataaaaccccgaacctcgagactttctccttatcgtaaacaacaggcgacccaccacggatcatttcacccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671898 |
ctcagaagaatcttcagcattcttggataaaaccccgaacctcgagactttctccttatcgtaaacaacaggcgacccaccacggatcatttcacccaat |
29671997 |
T |
|
| Q |
101 |
ttaaacacaacttgttgat |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29671998 |
ttaaacacaacttgttgat |
29672016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 220 times since January 2019
Visitors: 3675