View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_29 (Length: 204)
Name: NF0551_low_29
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0551_low_29 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 760607 - 760530
Alignment:
Q |
127 |
caatccgtttgaatcatgttaaagaaaaagctgatacacttgtagcatgacatcataattcaatttccaaatggattc |
204 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
T |
760607 |
caatacgtttgaatcatgttaaagaaaaagctgatacacttgtggcatgacatcatcattcaatttacaaatggattc |
760530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University