View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_3 (Length: 456)
Name: NF0551_low_3
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0551_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 30 - 266
Target Start/End: Original strand, 39402206 - 39402441
Alignment:
Q |
30 |
tgttcaatgtgattgtgattatctctgaattgaacttatgctttgcttagcagtattaatctttgttagcagtattaatctttgttgcatgtgaaataca |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39402206 |
tgttcaatgtgattgtgattatctctgaattgaacttatgctttgcttagcagtattaat-tttgttagcagtattaatctttgttgcatgtgaaataca |
39402304 |
T |
 |
Q |
130 |
cctgccacctatgaagattattgctgcaagattgatttgaatttatttactcaataaagtcatgtgtaccacttgattcatgttctttaaaccttataca |
229 |
Q |
|
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39402305 |
cctgccacctgtgaagattattgctccaagattgatttgaatttatttactcaataaagtcatgtgtaccacttgattcatgttctttaaaccttataca |
39402404 |
T |
 |
Q |
230 |
aggttgattctggtcattaaaaccaaacaaacaagta |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
39402405 |
aggttgattctggtcattaaaaccaaacaaacaagta |
39402441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University