View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0551_low_7 (Length: 357)
Name: NF0551_low_7
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0551_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 230
Target Start/End: Original strand, 40010773 - 40010973
Alignment:
| Q |
30 |
ttgatatcatatcagaaggattggatactttgaaaaatctagcccttgatatgaatgaggttacgaatcttgtctttctagtaattccacttggaaatgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010773 |
ttgatatcatatcagaaggattggatactttgaaaaatctagcccttgatatgaatgaggttacgaatcttgtctttctagtaattccacttggaaatgt |
40010872 |
T |
 |
| Q |
130 |
ttgattttaagaggataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggatgaaatggacgcaaagg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010873 |
ttgattttaagaggataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggatgaaatggacgcaaagg |
40010972 |
T |
 |
| Q |
230 |
t |
230 |
Q |
| |
|
| |
|
|
| T |
40010973 |
t |
40010973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 260 - 349
Target Start/End: Original strand, 40010985 - 40011074
Alignment:
| Q |
260 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010985 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
40011074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University