View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_12 (Length: 476)
Name: NF0552_high_12
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0552_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 30 - 469
Target Start/End: Complemental strand, 2097482 - 2097042
Alignment:
Q |
30 |
gaagctgcaactcttgccgaggcagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgagctgg |
129 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
2097482 |
gaagctgcaactcttgccgaggtagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgacctgg |
2097383 |
T |
 |
Q |
130 |
gttggatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacggatgctagctagaaatagagtcaat |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
2097382 |
gttggatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacagatgctagctagaaatagagtcaat |
2097283 |
T |
 |
Q |
230 |
tctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnacgagttttaggtctaagaaaaaccaaggtttggt |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||| |
|
|
T |
2097282 |
tctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgagttttttttacgagtcttaggtctaagaaaaaccaaagtttggt |
2097183 |
T |
 |
Q |
330 |
ctggc-tttagtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggt |
428 |
Q |
|
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2097182 |
ctggcttttagtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggt |
2097083 |
T |
 |
Q |
429 |
tctctctgatgttgggggttctgtggggggtttctctgctg |
469 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2097082 |
tctctctgatgttgggggttctgtggggggtttctctgctg |
2097042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1176 times since January 2019
Visitors: 3665