View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_20 (Length: 383)
Name: NF0552_high_20
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 10 - 354
Target Start/End: Complemental strand, 30042234 - 30041890
Alignment:
| Q |
10 |
attattctgcaaattatattaatgttgaagtccatgatcctagtcaaggaagatggcatttacaagtttttatggattcctataagggagtcgaagacgc |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30042234 |
attattctgaaaattatattaatgttgaagtccgtgatcctagtcaagggagatggcatttacaagtttttatggattcctataagggagtcgaagacgc |
30042135 |
T |
 |
| Q |
110 |
aattcttgggattttttgagaaatttatcttgtggtacttcgcttcaatagtgtatccttggtgattttaatgatattttggatatctatgaaaagtgag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30042134 |
aattcttgggattttttgagaaatttatcttgtggtacttcgcttcaatggtgtatccttggtgattttaatgatattttggatatctatgaaaagtgag |
30042035 |
T |
 |
| Q |
210 |
ggggctttaagcgtgctaggtggttgattaacgatttaagataggttgttttttatgcaggtttaattgatgtgttaaaggagggggtattcttttacct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30042034 |
ggggctttaagcgtgctaggtggttgattaacgatttaagataggttgttttttatgcaggtttaattgatatgttaaaggagggggtattcttttacct |
30041935 |
T |
 |
| Q |
310 |
agtttaagagttcaggtactcctagagcagttaaagaaagatcgg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30041934 |
agtttaagagttcaggtactcctagagcagttaaagaaagatcgg |
30041890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 21114686 - 21114761
Alignment:
| Q |
10 |
attattctgcaaattatattaatgttgaagtccatgatcctagtcaaggaagatggc-atttacaagtttttatgg |
84 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||||||||||| ||| ||||| ||||||| |||||||||| |
|
|
| T |
21114686 |
attattctgctaatcatattaatgttgaagtcaatgatcctagtcgagggccatggcaatttacaggtttttatgg |
21114761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University