View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_25 (Length: 336)
Name: NF0552_high_25
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 97 - 325
Target Start/End: Complemental strand, 41084528 - 41084300
Alignment:
| Q |
97 |
caagtataacacttcccttcattgctcctccttcatctcctgcatcattcttccaatctgaacctccttcaacagcacaatcaccggtcggtatattatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41084528 |
caagtataacacttcccttcattgctcctccttcatctcctgcatcattcttccaatctgaacctccttcaaccgcacaatcaccggtcggtatattatc |
41084429 |
T |
 |
| Q |
197 |
caaaacttctgtatctgcaagcatgtactcacctggtggccctaactcaatctttgccatcggcccttacgcacacgaaacacaattggtttctccgcct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084428 |
caaaacttctgtatctgcaagcatgtactcacctggtggccctaactcaatctttgccatcggcccttacgcacacgaaacacaattggtttctccgcct |
41084329 |
T |
 |
| Q |
297 |
gttttctcggcctcttcaacagctccttt |
325 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
41084328 |
gttttctcggcttcttcaacagctccttt |
41084300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University