View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_30 (Length: 320)
Name: NF0552_high_30
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0552_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 88 - 262
Target Start/End: Complemental strand, 2859937 - 2859767
Alignment:
Q |
88 |
agtaactagtaaattggttaaatactaactacaattcaaaacaaaaagcttaagcttgcatgtttatttcaactacattgttttataattctcttaaaaa |
187 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2859937 |
agtaactagtaaattggttaaatacta----caattcaaaacaaaaagcttaagcttgcatgtttatttcaactacattgttttataattctcttaaaaa |
2859842 |
T |
 |
Q |
188 |
ttattttttaaacaaaataaacttgattttgaccggtcctctannnnnnnnaattgcgtaattttggtccctcac |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||| |
|
|
T |
2859841 |
ttattttttaaacaaaataaacttgattttgatcggtcctctattttttttaattgcctaattttggtccctcac |
2859767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 36 times since January 2019
Visitors: 3673