View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0552_high_32 (Length: 311)

Name: NF0552_high_32
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0552_high_32
NF0552_high_32
[»] chr3 (1 HSPs)
chr3 (1-213)||(31769169-31769381)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 31769381 - 31769169
Alignment:
1 aagaagctgtccaatgtgaaggtgagcaagatatgacaccaatattaataattttggaagggcactagacaggacacccccactagaccagaagaatcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31769381 aagaagctgtccaatgtgaaggtgagcaagatatgacaccaatattaataattttggaagggcactagacaggacacccccactagaccagaagaatcag 31769282  T
101 cctttaaaatcaaccccacccaccatacattattaaggcttacaccaggggaccgccagtactaagctgctgtatgcataattgcataggacctttccaa 200  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||    
31769281 cctttaaaatcaaacccacccaccatacattattaaggcttacaccaggggaccgccagtactaaactgctgtatgcataattgcatagggcctttctaa 31769182  T
201 acttattaataat 213  Q
    |||||||||||||    
31769181 acttattaataat 31769169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University