View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_33 (Length: 311)
Name: NF0552_high_33
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 31769381 - 31769169
Alignment:
| Q |
1 |
aagaagctgtccaatgtgaaggtgagcaagatatgacaccaatattaataattttggaagggcactagacaggacacccccactagaccagaagaatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769381 |
aagaagctgtccaatgtgaaggtgagcaagatatgacaccaatattaataattttggaagggcactagacaggacacccccactagaccagaagaatcag |
31769282 |
T |
|
| Q |
101 |
cctttaaaatcaaacccacccaccatacattattaaggcttacaccaggggaccgccagtactaagctgctgtatgcataattgcataggacctttccaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| || |
|
|
| T |
31769281 |
cctttaaaatcaaacccacccaccatacattattaaggcttacaccaggggaccgccagtactaaactgctgtatgcataattgcatagggcctttctaa |
31769182 |
T |
|
| Q |
201 |
acttattaataat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31769181 |
acttattaataat |
31769169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 400 times since January 2019
Visitors: 3650