View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_35 (Length: 302)
Name: NF0552_high_35
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 33268564 - 33268742
Alignment:
| Q |
20 |
gtttgtgtacttaatatgaaattggtttgacannnnnnn--gtcttctgctgtaagaaagctcaatttgttgactttgaatataagaaagcttaatttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268564 |
gtttgtgtacttaatatgaaattggtttgacattttttattgtcttctgctgtaagaaagctcaatttgttgactttgaatataagaaagcttaatttag |
33268663 |
T |
|
| Q |
118 |
ttgatttttcaagttaattgtcttgtttagttagatggaatcctaaaattttatatatttcctaatagttccttctggg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268664 |
ttgatttttcaagttaattgtcttgtttagttagatgcaatcctaaaattttatatatttcctaatagttccttctggg |
33268742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 72 times since January 2019
Visitors: 3673