View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_36 (Length: 293)
Name: NF0552_high_36
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 42329384 - 42329264
Alignment:
| Q |
30 |
tcacgaccatgtttcatctagataaataggagggctctacttctttttacacttaagaatgctcccccttaggcactaattttaagtttaaaggatttgg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42329384 |
tcacgaccatgtttcatctagataaataggagggctctacttctatttacacttaagaatgctcccccttaggcactaattttaagtttaaaggatttgg |
42329285 |
T |
|
| Q |
130 |
gatattacaagatcctacaca |
150 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42329284 |
gatattacaagatcctacaca |
42329264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 68 - 144
Target Start/End: Original strand, 12849369 - 12849445
Alignment:
| Q |
68 |
acttctttttacacttaagaatgctcccccttaggcactaattttaagtttaaaggatttgggatattacaagatcc |
144 |
Q |
| |
|
||||||| |||||||||||||||||| ||| ||||| |||||| | |||| ||||||||||||||||| |||| |
|
|
| T |
12849369 |
acttcttattacacttaagaatgctcttacttgatcactatttttaattataaacgatttgggatattacaaaatcc |
12849445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1741 times since January 2019
Visitors: 3673