View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_43 (Length: 265)
Name: NF0552_high_43
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 249
Target Start/End: Complemental strand, 17329981 - 17329732
Alignment:
| Q |
2 |
tgaatttcaccatgagttacctttgatttcaactaaaagctttggataatggatgttggagaagaaagtgtaaatgagatagagtaatt-gattgatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| |
|
|
| T |
17329981 |
tgaatttcaccatgagttacctttgatttcaactaaaagctttggataatggatgttggagaagaaagtgtaaatgagatagagtcatttgtttgatcaa |
17329882 |
T |
 |
| Q |
101 |
atactatattgattattcattgtataatgaaatttgatacaaccgttgctttatactagtgtcttgtattcattgtattcacggaatcaaccaattgatc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17329881 |
atactatattgattattcattttataatgaaatttgatacaaccgttgctttatactagtgtcttgtattcattgtattcacggaatcaaccaattgatc |
17329782 |
T |
 |
| Q |
201 |
ctcgactttcttttggaggcatttcctcattgc-ttattttcttcttctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
17329781 |
ctcgactttcttttggaggcatttcctcattgcttttttttcttcttctc |
17329732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University