View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_high_45 (Length: 252)
Name: NF0552_high_45
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 47771041 - 47771289
Alignment:
| Q |
1 |
cactcttccaacctttctcaaacttaatgaacctaaaaaattgacatat-----actcaactaattttgtactcaccagccctcattctactagactaac |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
47771041 |
cactcttccgacctttctcaaacttaatgaacctaaaaaattgacatatcttatagtcaactaattttgtactcactagccctcgttctactagactaac |
47771140 |
T |
|
| Q |
96 |
aacttaattattttcacggtaaagagttaaatttcagacaaaactatatttagatttatacaatgaatatgtcataaaatattatgtagagacggcaatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47771141 |
aacttaattattttcacggtaaagagttaaatttcagacaaaactatatttagatttatacaatgaatatgtcataaaatattatgtagagacggcaatt |
47771240 |
T |
|
| Q |
196 |
tggtattattacatcatagtccaccattgcattgcttcttcttcatctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47771241 |
tggtattattacatcatagtccaccattgcattgcttcttcttcttctc |
47771289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 107 times since January 2019
Visitors: 3674