View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_26 (Length: 376)
Name: NF0552_low_26
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 86 - 376
Target Start/End: Original strand, 41658610 - 41658902
Alignment:
| Q |
86 |
agatcacaacataatagtagcaactacaaccacacaagtcagaatctcaaa-gaacataacatataccaccatgctagctattatagtggcattaagaaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
41658610 |
agatcacaacataatagtagcaactacaaccacacaagtcagaatctcaaaagaacataacatataccaccatgctagctattatagcggcattaaggaa |
41658709 |
T |
|
| Q |
185 |
gatcatatatgcttacg-ctatcaaaacttgacacagctaccaaaatattataaaactgtctatagatccttatcccaatagatataaaggattaatagt |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658710 |
gatcatatatgcttacgtctatcaaaacttgacacagctaccaaaatattataaaactgtctatagatccttatcccaatagatataaaggattaatagt |
41658809 |
T |
|
| Q |
284 |
ttcataaaagtttagattttgtcaaagtgcttgattgaagtctactgcattttgtgtcaatcagctacaaaattgagcatcttcttttgcttc |
376 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658810 |
ttcataaaagtttagattttgccaaagtgcttgattgaagtctactgcattttgtgtcaatcagctacaaaattgagcatcttcttttgcttc |
41658902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 106 times since January 2019
Visitors: 3647