View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_29 (Length: 356)
Name: NF0552_low_29
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0552_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 322
Target Start/End: Complemental strand, 47770854 - 47770551
Alignment:
Q |
13 |
aatataaagaactacgcattacttgcgaaactagtcgcatgagactagattttgtaggccataatattttggctagtcggaactagttttctctataaat |
112 |
Q |
|
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
47770854 |
aatagaaagaactacgcattacttgccaaactagtcgcatgagactagattttgtaggtcataatattttggctagtcagaactagttttctctataaat |
47770755 |
T |
 |
Q |
113 |
gcctcgtggtatatttcatttcaacaaacatgtctaactttgcaaattcatctttatctttatctttatcttcctgatttacttttacttatgcaattca |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
T |
47770754 |
gcctcgtggtatatttcatttcaacaaacatgtctaattttgcaaattcatctttatcttta------tcttactgatttacttttacttatgcaattca |
47770661 |
T |
 |
Q |
213 |
taattataataggtcacccaaattctaaaattgtatttaacacttcttagaagaggtaaggaatctagagctgagacacggttctttctttagcgctatt |
312 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| || |||||||||| |||||||||||||||||||| |
|
|
T |
47770660 |
taattataataggtcacccaaattctaaaattgtatttaacacttcttagaagagttaagaaatttacagctgagacagagttctttctttagcgctatt |
47770561 |
T |
 |
Q |
313 |
ttaaagcaca |
322 |
Q |
|
|
|| ||||||| |
|
|
T |
47770560 |
ttgaagcaca |
47770551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 481 times since January 2019
Visitors: 3651