View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_43 (Length: 308)
Name: NF0552_low_43
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0552_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 25 - 280
Target Start/End: Original strand, 26532266 - 26532522
Alignment:
Q |
25 |
tagtgtgtctttgggggtaaccttcactaatcaagtaaaacggttcagaatgatacatttatctgtacacagtttgagtaaacatcatatgaacaaatgg |
124 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
26532266 |
tagtgtgtctttgggggtaaccttcactaatcaagtaaaacggttcagaatcatacatttatctgtacacagtttgagtaaacatcataggaacaaatgg |
26532365 |
T |
 |
Q |
125 |
ttcttaaacttttgttatcatcaaaatattaaggtcactgtttctagactaagttggttccagacactttcatatcttggtttactaatgt-aataactc |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
26532366 |
ttcttaaacttttgttatcatcaaaatattaaggtcactgtttctagactaagttggttccagacactttcatatcttggtttactaatgtaaataactc |
26532465 |
T |
 |
Q |
224 |
actcactctcattgtttatgcctcgataggaaaaccaataatattgataaaattatt |
280 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26532466 |
actcactctcattgtttatgcctcgataggaaaaccaataatattgataaaattatt |
26532522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University