View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_47 (Length: 291)
Name: NF0552_low_47
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 50 - 227
Target Start/End: Original strand, 36716600 - 36716777
Alignment:
| Q |
50 |
atgaagtagtcttcttaggtgaggatttcttgattttattttagtgactctctgctatgtcttgttcttatcaagtggttggctgcatatggaaaccaat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716600 |
atgaagtagtcttcttaggtgaggatttcttgattttattttagtgactctctgctatgtcttgttcttatcaagtggttggctgcatatggaaaccaat |
36716699 |
T |
 |
| Q |
150 |
caggactcttttgttttggtgcaacattttctcaaatttagctcttctcttatgcaacaaaattaggatgccacaatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716700 |
caggactcttttgttttggtgcaacattttctcaaatttagctcttctcttatgcaacaaaattaggatgccacaatt |
36716777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University