View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_48 (Length: 283)
Name: NF0552_low_48
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 7430918 - 7430664
Alignment:
| Q |
1 |
ttttgttttgattactgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattggttttgatgtccaa |
100 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430918 |
ttttgttttgaatagtgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattggttttgatgtccaa |
7430819 |
T |
|
| Q |
101 |
gacattgtatgaattgtatacatcataattcatagtgtagatcttgaaatatgaaaatgccttgtggaattggctggacatttgtaatgaacataggctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430818 |
gacattgtatgaattgtatacatcataattcatagtgtagatcttgaaatatgaaaatgtcttgtggaattggctggacatttgtaatgaacataggctt |
7430719 |
T |
|
| Q |
201 |
ttcaagtgattttgttaaacatgtatgtaatgtatggtctgtagtcctagcattt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430718 |
ttcaagtgattttgttaaacatgtatgtaatgtatggtctgtagtcctagcattt |
7430664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 206
Target Start/End: Original strand, 413433 - 413487
Alignment:
| Q |
152 |
tgaaaatgccttgtggaattggctggacatttgtaatgaacataggcttttcaag |
206 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
413433 |
tgaaaatgcattgtggaattggttggacatttgtaatgaacacaggattttcaag |
413487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 889 times since January 2019
Visitors: 3657