View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_50 (Length: 280)
Name: NF0552_low_50
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_50 |
 | |
|
| [»] scaffold0246 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 31769357 - 31769546
Alignment:
| Q |
1 |
tcaccttcacattggacagcttctttttggtgctcatttcagggtcttgtcaccaataggggatccacttttgccaaaaatgttatattccaattggtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769357 |
tcaccttcacattggacagcttctttttggtgctcatttcagggtcttgtcaccaataggggatccacttttgccaaaaatgttatattccaattggtcc |
31769456 |
T |
|
| Q |
101 |
ttattggtgcatacaaaataaatcgtatcaatttgattttctgaaatcttaaatgtttgccaaatatagtcctatatacacaattcaaat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769457 |
ttattggtgcatacaaaataaatcgtatcaatttgattttctgaaatcttaaatgtttgccaaatatagtcctatatacacaattcaaat |
31769546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 199 - 268
Target Start/End: Original strand, 31769532 - 31769601
Alignment:
| Q |
199 |
atacacaattcaaatcttttttggagtgtgtaggcaattacttgatgatgttcctgtgcaggctaatatt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31769532 |
atacacaattcaaatcttttttggagtgtgtaggcaattacttgatgatgtttctgtgcaggctaatatt |
31769601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 22351 - 22309
Alignment:
| Q |
226 |
gtgtaggcaattacttgatgatgttcctgtgcaggctaatatt |
268 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
22351 |
gtgtaggcaattacttgatggtgttattgtgcaggctaatatt |
22309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 40484412 - 40484370
Alignment:
| Q |
226 |
gtgtaggcaattacttgatgatgttcctgtgcaggctaatatt |
268 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
40484412 |
gtgtaggcaattacttgatggtgttattgtgcaggctaatatt |
40484370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 551 times since January 2019
Visitors: 3653