View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_53 (Length: 274)
Name: NF0552_low_53
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 29 - 264
Target Start/End: Original strand, 34095404 - 34095639
Alignment:
| Q |
29 |
aaacaccaccaacaacaataataacactgttttggttggttctggttatgttccttttgttggttctaacgttggtgctggatggattgtgcctaacaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095404 |
aaacaccaccaacaacaataataacactgttttggttggttctggttatgttccttttgttggttctaacgttggtgctggatggattgtgcctaacaat |
34095503 |
T |
|
| Q |
129 |
cacaatcagaatcagaataacattaacaacagggttgttgttggtggcggtaactatggatctggttcactactttgtagtagtagaaacccttttgagc |
228 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095504 |
cagaatcagaatcagaataacattaaaaacagggttgttgttggtggtggtaactatggatctggttcactactttgtagtagtagaaacccttttgagc |
34095603 |
T |
|
| Q |
229 |
cttctaaagagctctcttcaatgccaaatcttcatc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095604 |
cttctaaagagctctcttcaatgccaaatcttcatc |
34095639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1142 times since January 2019
Visitors: 3663