View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_57 (Length: 259)
Name: NF0552_low_57
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0552_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 28 - 180
Target Start/End: Complemental strand, 36886684 - 36886532
Alignment:
Q |
28 |
gagtgagatgaaatgaaattgaatatttaaggactgagttatatacaacatgcaagtatatttctaaggatcagaataccagttgattaattatgttcat |
127 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
36886684 |
gagtgaaatgaaatgaaattgaatatttaaggactgagttatatacaacatgcaagtatatttctaaggatcagaataccagttgattagttatgttcat |
36886585 |
T |
 |
Q |
128 |
attgattttagaccaagcttaatagacatgataataatacagagcaacagcta |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36886584 |
attgattttagaccaagcttaatagacatgataataatacagagcaacagcta |
36886532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University