View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_61 (Length: 251)
Name: NF0552_low_61
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 32274642 - 32274467
Alignment:
| Q |
1 |
aacagatttttacttagggcctttaatttgtgactttcttattgtcactgtgataataaaacatannnnnnncccttctatcttagcatttcataatt-c |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||| | |
|
|
| T |
32274642 |
aacagatttttacttagggcctttaatttgtgactatcttattgtcactgtgataataaaacagattttaatcccttctatcttagcatttcataatttc |
32274543 |
T |
|
| Q |
100 |
cactttattcttactctatttctgttcttgcattctgcatctgaatcgttgatcattttaatatgttatcatatga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32274542 |
cactttattcttactctatttctgttcttgcattctgcatctgaatcgttgatcattttaatatgttatcatatga |
32274467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 32274483 - 32274429
Alignment:
| Q |
197 |
aatatgttatcatatgatgttatgttatattcaacctggttggaatcaatctgtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
32274483 |
aatatgttatcatatgatgttatgttatactcaacctggttggaatcaatttgtg |
32274429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 308 times since January 2019
Visitors: 3649