View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0552_low_67 (Length: 238)
Name: NF0552_low_67
Description: NF0552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0552_low_67 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 44 - 238
Target Start/End: Complemental strand, 23991405 - 23991211
Alignment:
| Q |
44 |
gctgtgtttgaactttgggtgcatttgcatttgacccaaaaacaagcttccctgaagttctattggaattgttggagttattttcagtatgttgcttctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
23991405 |
gctgtgtttgaactttgggtgcatttgcctttgagccaaaaacaagattccctgaagttctattggaattgtttgagttattatcagtatgttgcttctt |
23991306 |
T |
 |
| Q |
144 |
tggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcctcccgataccactgaatggcatcagtcttggaacct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23991305 |
tggaactggagtggaagcttgttcaactaattgtgtcgacggtttaccatccaaacgcctcccgataccactgaatggcatcagtcttggaacct |
23991211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 44 - 234
Target Start/End: Complemental strand, 23984741 - 23984551
Alignment:
| Q |
44 |
gctgtgtttgaactttgggtgcatttgcatttgacccaaaaacaagcttccctgaagttctattggaattgttggagttattttcagtatgttgcttctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
23984741 |
gctgtgtttgaactttgggtgcatttgcctttgagccaaaaacaagcttccctgaagttctattagaattgtttgagttattttcagtatgttgcttctt |
23984642 |
T |
 |
| Q |
144 |
tggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcctcccgataccactgaatggcatcagtcttgga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23984641 |
tggaactggagtggaagcttgttcaactgattgtgtcgacggtttaccatccaaacgcctcccgataccactgaatggcatcagtcttgga |
23984551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 44 - 203
Target Start/End: Complemental strand, 23967813 - 23967654
Alignment:
| Q |
44 |
gctgtgtttgaactttgggtgcatttgcatttgacccaaaaacaagcttccctgaagttctattggaattgttggagttattttcagtatgttgcttctt |
143 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||||||||| | ||||||| | ||| |||||| ||||||||||| ||||||| ||| |
|
|
| T |
23967813 |
gctgtgtttgaacattggatgcattggcatttgacccaaaaacaagcttcccaggagttctaatcgaactgttggttttattttcagtttgttgctgctt |
23967714 |
T |
 |
| Q |
144 |
tggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcct |
203 |
Q |
| |
|
| || |||||| |||| |||||| | | |||||| ||| |||||||||||||||||||| |
|
|
| T |
23967713 |
tataattggagtagaagtttgttcgattgattgtgccgacggtttaccatccaaacgcct |
23967654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University