View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_high_14 (Length: 291)
Name: NF0553_high_14
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 72 - 223
Target Start/End: Complemental strand, 15793669 - 15793518
Alignment:
Q |
72 |
tgagacactgagactctttggcttgttgggtttttatagtgaaaaatattttcaatttaaatttttaagtggcttgggaagcaagctcttgttccataat |
171 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15793669 |
tgagacactgagactctttggcttgttgggtttttatagtgaaaaatattttcaatttaaatttttaagtggcttgggaagcaagctcttgttccataat |
15793570 |
T |
 |
Q |
172 |
tgaatggacacatcatcgaggagtgtgccacataagatgccaggatggaatt |
223 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15793569 |
tgaatagacacatcatcgaggagtgtgccacataagatgccaggatggaatt |
15793518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University