View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_high_15 (Length: 280)
Name: NF0553_high_15
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 3 - 269
Target Start/End: Original strand, 10102129 - 10102389
Alignment:
| Q |
3 |
gttttgtgcagccacaccctcagaatcaccgtgagtactcatgttgaatttatttgctctaaagcttaattgtgaatgtatttcaaatacagatgcgtgc |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10102129 |
gttttgtgcagccacaccctcagagtcaccgtgagtactcatgttgaatttatttgctctaaagcttaattgtgaat----ttcaaatacagatgcgtgc |
10102224 |
T |
|
| Q |
103 |
agctgtgcgtgaagttgctagttattttcctactgccattattagtggaaggagtagaaataaggtaaaacattcacttaattaataatactgaatcata |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10102225 |
agctgtgcgtgaagttgctagttattttcctactgccattattagtggaagaagtagaaataaggtaaaacattcacttaat---taatactgaatcata |
10102321 |
T |
|
| Q |
203 |
tagatatcc-ttttttcttaggctctttgcattgttccattttagtctagtatttacatgacattcat |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10102322 |
tagatatcctttttttcttaggctctttgcattgttcctttttagtctagtatttacatgacattcat |
10102389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 637 times since January 2019
Visitors: 3655