View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_high_18 (Length: 253)
Name: NF0553_high_18
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 55074063 - 55074179
Alignment:
| Q |
1 |
ctcccctgttcaattgtaccatccaattgatactat--ggcaatgcatcgatactaagttataattttcgactttacattcaatcaccattctctttatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
55074063 |
ctcccctgttcaattgtaccatccaattgatactatatgtcaatgcatcgatactaagttataattttcgactttgcatttaatcaccattctctttatt |
55074162 |
T |
|
| Q |
99 |
tcatttactatcatatt |
115 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
55074163 |
tcttttactatcatatt |
55074179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1455 times since January 2019
Visitors: 3669