View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_high_25 (Length: 218)
Name: NF0553_high_25
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 49019059 - 49019210
Alignment:
Q |
44 |
tccaggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggtatgtggcctttttacttgatttt |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49019059 |
tccaggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggtatgtggcctttttacttgatttt |
49019158 |
T |
 |
Q |
144 |
tctgaagtttaaattttatatctgggttggaattatttattgaatttgatgatg |
197 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
49019159 |
tctgaagttt--gttttacatctgggttggaattatttattgaatttgatgatg |
49019210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 8345161 - 8345314
Alignment:
Q |
44 |
tccaggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggtatgtggcctttttacttgatttt |
143 |
Q |
|
|
|||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
T |
8345161 |
tccaggaaaattgatgtagggatttcgtccaattcaacttctgatgaattgattggtgaaaatatagaatgtcaggtatgtggcctttttaattaatttt |
8345260 |
T |
 |
Q |
144 |
tctgaagtttaaattttatatctgggttggaattatttattgaatttgatgatg |
197 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
8345261 |
tctgaagtttaaattttatatctggtttggaattatttattgaatttgatgatg |
8345314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 44 - 197
Target Start/End: Complemental strand, 42824453 - 42824300
Alignment:
Q |
44 |
tccaggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggtatgtggcctttttacttgatttt |
143 |
Q |
|
|
|||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
T |
42824453 |
tccaggaaaattgatgtagggatttcgtccaattcaacttctgatgaattgattggtgaaaatatagaatgtcaggtatgtggcctttttaattaatttt |
42824354 |
T |
 |
Q |
144 |
tctgaagtttaaattttatatctgggttggaattatttattgaatttgatgatg |
197 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
42824353 |
tctgaagtttaaattttatatctggtttggaattatttattgaatttgatgatg |
42824300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 49 - 120
Target Start/End: Original strand, 50861266 - 50861337
Alignment:
Q |
49 |
gaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggt |
120 |
Q |
|
|
|||||||||||| |||||||| |||||||||||| |||||||||||||| ||| |||||||||||| ||||| |
|
|
T |
50861266 |
gaaaattgatgttgggatttcgtcgaattcaactactggtgaattgattggtggaaatagagaatgccaggt |
50861337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 39073819 - 39073745
Alignment:
Q |
46 |
caggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggt |
120 |
Q |
|
|
||||||||||||||| |||||| || ||||| |||| ||||||||||||| || |||||||||||||||||| |
|
|
T |
39073819 |
caggaaaattgatgtttggattttgtcaaattcgacttttggtgaattgattgatggaaatagagaatgtcaggt |
39073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 36588170 - 36588096
Alignment:
Q |
46 |
caggaaaattgatgtagggatttcatcgaattcaacttctggtgaattgattagtgaaaatagagaatgtcaggt |
120 |
Q |
|
|
||||||||||||| | |||||||| || ||||| |||||||||||||||||| | | | ||||||| |||||||| |
|
|
T |
36588170 |
caggaaaattgatcttgggatttcgtcaaattcgacttctggtgaattgattggcggatatagagattgtcaggt |
36588096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 197
Target Start/End: Original strand, 30331035 - 30331070
Alignment:
Q |
162 |
tatctgggttggaattatttattgaatttgatgatg |
197 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| |
|
|
T |
30331035 |
tatctgggtcggaattatttattgaatttgatgatg |
30331070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 181 times since January 2019
Visitors: 3648