View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0553_high_31 (Length: 201)

Name: NF0553_high_31
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0553_high_31
NF0553_high_31
[»] chr3 (1 HSPs)
chr3 (1-70)||(55074063-55074134)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 55074063 - 55074134
Alignment:
1 ctcccctgttcaattgtaccatccaattgatac--tatggcaatgcatcgatactaagttatattattcgac 70  Q
    |||||||||||||||||||||||||||||||||  |||| ||||||||||||||||||||||| | ||||||    
55074063 ctcccctgttcaattgtaccatccaattgatactatatgtcaatgcatcgatactaagttataattttcgac 55074134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University